• Question: What important substance is inside the DNA that can makes us, us?

    Asked by Paka Maka the 1st (Adira) to Stéphane, Gemma on 13 Mar 2018. This question was also asked by Teza & Emi.
    • Photo: Stéphane Berneau

      Stéphane Berneau answered on 13 Mar 2018:

      Really good questions.
      As you probably know, DNA is a really long chain composed of bases (A T C or G) which is paired with another complementary base chain (A in front of T and C in front of G). The structure is a propeller twist and once very condensed, you can observed chromosomes.
      In each cells which create your body (also known as somatic cells), you have both a paternal and maternal chromosomes forming a pair. In total, humans have 23 pairs of chromosomes (22 autosomal pair and 1 sexual pairs).
      Genes are positionned at the same place on both maternal and paternal chromosomes.
      For example, the genes responsible for your eye colour are on the chromosome 15 in humans.
      Alleles can be different depending on country, origins…
      The paternal gene might have a different allele than the mother’s one. Allele is a copy of a gene.
      In summary, there are about 19 000 – 20 000 genes coding (meaning creating a different protein) and each gene can have different alleles. And it is the entire combination of alleles that makes who you are (and different from your parents and siblings.

      I have selected a short video for you. If you enjoyed my answer, please vote for me and my project! (you can vote every single day)

    • Photo: Gemma Chandratillake

      Gemma Chandratillake answered on 15 Mar 2018:

      Hi Paka Maka,
      It’s not that there is an important substance inside DNA, its the DNA itself that is the important substance. DNA contains the code that makes us, us. If you look at this picture of DNA, it is a spiral with four types of “nitrogenous base” paired together in steps in the middle: https://www2.le.ac.uk/projects/vgec/schoolsandcolleges/topics/dnageneschromosomes
      These “bases” are called A, G, C and T, and the sequence they are in along the DNA molecule is the actual code that makes us, us: AACTTTGCGCGTTAAATGCCCAAA etc, on and on like that, with 3 billion letters!
      There are 3 billion letters in the DNA code of a person, but most of them are the same in all humans. Only 3 million of the letters, 1 in 1000, are different between one person and the next. In those 3 million letters, are our differences, what makes us individuals (genetically speaking at least!). But 99.9% of our DNA is the same as the next person!
      Our genes are part of this 3 billion letter DNA code. If we have differences in the code of a particular gene, we might have a different version of a trait, or characterisitic e.g. there is a gene for blood groups called the ABO gene. Your blood group depends on what your DNA code is at this particular point in your genome. In the population, there are three different types (or alleles) of code for this gene “A”, “B” and “O”. So what code you have depends on what you inherited from your parents; what blood group you are depends on the combination of the DNA code you got from your mum and the DNA code you got from your dad.

Comments